
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-701-3p를 표적하는 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 디자인을 적용하여 강력한 억제 효과를 제공합니다. 다양한 세포 유형에 효율적으로 전달 가능하며, 퓨로마이신 저항성 유전자를 포함해 안정적인 장기 억제를 구현합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-701-3p
- 형태: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태(Form) | Liquid |
| 농도(Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열(Mature Sequence) | UAUCUAUUAAAGAGGCUAGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0017257 |
| microRNA 수납 번호 | MI0004685 |
| 배송 상태(Shipping Condition) | Dry ice |
| 저장 온도(Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
MicroRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which allows co-transfection with compatible packaging plasmids to produce viral particles for mammalian cell transduction.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 적용 가능
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



