Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-1199-3p

Design Type

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGCGGCCGGUGCUCAGUCGGC

Sanger 성숙/소수 수납 번호

• MIMAT0017333

microRNA 수납 번호

• MI0006307

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to enable potent inhibition of specific miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 효과
• Lentiviral delivery로 다양한 세포주에 효율적 전달
• 반복적 형질감염 없이 장기 억제 가능
• Puromycin 선택 마커 및 WPRE 요소 포함