Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-1902를 표적하는 렌티바이러스 기반 microRNA 억제제입니다. Tough Decoy(TuD) 설계를 적용해 강력한 miRNA 억제 효과를 제공합니다. 다양한 세포형에 효율적으로 전달되며, 장기적인 억제 효과를 유지합니다. −70°C에서 건빙 상태로 배송됩니다.
- 카탈로그번호
- MLTUD0874
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 miRNA
- mmu-miR-1902
- 형태: Tough Decoy (TuD)
품질 등급
200
제품 라인
MISSION®
물리적 형태
liquid
농도
≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
AGAGGUGCAGUAGGCAUGACUU
등록 정보
| 항목 | 등록 번호 | 링크 |
|---|---|---|
| Sanger 성숙/소수 수납 번호 | MIMAT0007863 | mirBase 링크 |
| microRNA 수납 번호 | MI0008313 | mirBase 링크 |
배송 및 보관
| 항목 | 조건 |
|---|---|
| 배송 상태 | dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm uses the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA activity.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes:
- Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
- Puromycin resistance gene for cell selection
주요 특징
- 강력한 miRNA 억제 효과 제공
- 다양한 세포형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.