
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 TuD 디자인 제품. 효율적이고 장기적인 miRNA 억제 가능. 다양한 세포 유형에 안정적으로 전달. 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-466f
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) enhances transgene expression.
This vector also contains a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 방식으로 다양한 세포 유형에 효율적으로 적용
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
- 퓨로마이신 내성 유전자 포함으로 선택 용이
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACGUGUGUGUGCAUGUGCAUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0005844 |
| microRNA 수납 번호 | MI0006291 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



