Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-669h-5p

디자인

• Tough Decoy (TuD) 구조 적용

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AUGCAUGGGUGUAUAGUUGAGUGC

Sanger 성숙/소수 수납 번호

• MIMAT0005841

microRNA 수납 번호

• MI0006289

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, upon co-transfection with compatible packaging plasmids, produces viral particles suitable for transducing mammalian cells.

The vector includes:

• Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression
• Puromycin resistance gene for selection of transduced cells

주요 특징

• 강력한 miRNA 억제 성능
• 다양한 세포 유형에 효율적인 렌티바이러스 전달
• 반복적인 트랜스펙션 없이 장기적 억제 가능