Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

• mmu-miR-1b-3p

디자인

• Tough Decoy (TuD) 방식 적용

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UGGGUACAUAAAGAAGUAUGUGC

Sanger 성숙/소수 수납 번호

• MIMAT0017326

microRNA 수납 번호

• MI0006283

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.

The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included to enhance transgene expression.
This lentiviral vector also carries a puromycin resistance gene for selection of transduced cells.

주요 특징

• 원하는 miRNA의 강력한 억제 가능
• 렌티바이러스 전달 포맷으로 다양한 세포 유형에 효율적 전달
• 반복적인 트랜스펙션 없이 장기간 억제 유지
• 푸로마이신 내성 유전자로 선택적 세포 선별 가능