
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-669d-5p를 표적하는 Tough Decoy(TuD) 설계의 렌티바이러스 기반 microRNA 억제제. 효율적인 세포 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터와 퓨로마이신 선택 마커 포함. −70°C에서 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-669d-5p
Design
Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | ACUUGUGUGUGCAUGUAUAUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0005833 |
| microRNA 수납 번호 | MI0006281, MI0014051 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) enhances transgene expression.
The lentiviral vector includes a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 적용 가능
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



