
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-717 억제를 위한 렌티바이러스 기반 microRNA Inhibitor. Tough Decoy(TuD) 디자인으로 강력하고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 효율적으로 전달되며, 퓨로마이신 내성 유전자 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-717
Type: Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, co-transfected with compatible packaging plasmids to produce viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자를 통한 선택 용이성
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CUCAGACAGAGAUACCUUCUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003510 |
| microRNA 수납 번호 | MI0004704 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



