
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-714 억제용 렌티바이러스 기반 microRNA inhibitor Tough Decoy(TuD) 설계로 강력한 miRNA 억제 가능 다양한 세포에 효율적 전달 및 장기적 억제 유지 puromycin 선택 마커 및 WPRE 포함으로 발현 강화 −70°C에서 건빙 상태로 배송
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-714
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent and specific inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, co-transfected with compatible packaging plasmids to produce viral particles suitable for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for cell selection
Key Features:
- Potent inhibition of specific miRNA
- Efficient lentiviral delivery across various cell types
- Long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CGACGAGGGCCGGUCGGUCGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0003505 |
| microRNA 수납 번호 | MI0004699 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
참고 문헌
Haraguchi, T. et al., University of Tokyo — Development of Tough Decoy (TuD) design for microRNA inhibition.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



