
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계 제품. 효율적이고 장기적인 miRNA 억제 가능. 다양한 세포 유형에 안정적으로 전달. 푸로마이신 저항성 유전자 포함으로 선택 용이.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5627-5p
Type: Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to enable potent inhibition of specific miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGAGGGUGCGCCGGGCCCUGCG |
| 성숙/소수 수납 번호 (Sanger) | MIMAT0022385 |
| microRNA 수납 번호 | MI0019198 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



