
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용. TRC2-pLKO-puro 벡터에 클로닝되어 효율적 전달 및 장기 억제 가능. 푸로마이신 선택 마커 및 WPRE 포함으로 발현 강화. −70°C에서 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5709
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids yields viral particles suitable for mammalian cell transduction.
Additionally, the vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적 전달 가능 (렌티바이러스 포맷)
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AUACGCACACUUAAGACUUUAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0022504 |
| microRNA 수납 번호 | MI0019318 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



