CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 microRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 디자인 적용. TRC2-pLKO-puro 벡터에 클로닝되어 효율적 전달 및 장기 억제 가능. 푸로마이신 선택 마커 및 WPRE 포함으로 발현 강화. −70°C에서 드라이아이스 배송.

브랜드
Merck Sigma
카테고리
Other Organics
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD1279 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5709

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and specific inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids yields viral particles suitable for mammalian cell transduction.

Additionally, the vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.


주요 특징

  • 강력한 miRNA 억제 효과
  • 다양한 세포 유형에 효율적 전달 가능 (렌티바이러스 포맷)
  • 반복적인 트랜스펙션 없이 장기적인 억제 가능

제품 사양

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AUACGCACACUUAAGACUUUAG
Sanger 성숙/소수 수납 번호 MIMAT0022504
microRNA 수납 번호 MI0019318
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.