Merck MISSION Lenti microRNA Inhibitor, Mouse
개별 miRNA 억제를 위한 렌티바이러스 기반 억제제 TuD(Tough Decoy) 설계로 강력한 miRNA 억제 효과 제공 다양한 세포 유형에 효율적으로 전달 가능 장기간 억제 효과 유지, 반복 형질감염 불필요 −70°C에서 건빙 상태로 배송 및 보관
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-5130
Design: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CUGGAGCGCGCGGGCGAGGCAGGC |
| Sanger 성숙/소수 수납 번호 | MIMAT0020641 |
| microRNA 수납 번호 | MI0018042 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles suitable for transducing mammalian cells.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced expression of delivered transgenes
- Puromycin resistance gene for cell selection
주요 특징
- 강력한 목표 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
- 반복 형질감염 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.