CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

Lentiviral 기반 microRNA 억제제로 다양한 세포에 효율적으로 전달 가능. Tough Decoy(TuD) 디자인을 적용해 강력하고 지속적인 miRNA 억제 구현. Puromycin 선택 마커 포함으로 안정적 세포주 구축 용이. −70°C에서 보관, dry ice 배송.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD1232 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5131

Tough Decoy (TuD) Design


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent and stable inhibition of target miRNA.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

Co-transfection with packaging plasmids produces viral particles suitable for transduction of mammalian cells.


주요 특징

  • Potent inhibition of desired miRNA
  • Efficient lentiviral delivery into diverse cell types
  • Long-term inhibition without repeat transfection

제품 스펙

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 (Form) Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CGGCGCCCCACGGAGCCCCGAGC
Sanger 성숙/소수 수납 번호 MIMAT0020642
microRNA 수납 번호 MI0018043
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.