Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 효율적인 세포 내 전달 가능. Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제. Puromycin 선택 마커 포함으로 안정적 세포주 구축 가능. −70°C에서 보관, 드라이아이스 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-669a-5p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGUUGUGUGUGCAUGUUCAUGUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003477 |
| microRNA 수납 번호 | MI0004523 MI0004667 MI0004668 MI0014054 MI0014055 MI0014058 MI0014061 MI0014066 MI0014068 MI0014073 MI0014075 MI0014077 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- Lentiviral 전달 형식으로 다양한 세포 유형에 효율적 전달 가능
- 반복적인 트랜스펙션 없이 장기적인 억제 가능
- Puromycin 선택 마커 포함으로 안정적 세포주 구축 용이
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.