CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 강력한 miRNA 억제 기능을 제공합니다. 렌티바이러스 포맷으로 다양한 세포에 효율적으로 전달되며, 장기적인 억제 효과를 유지합니다. 퓨로마이신 저항 유전자를 포함하여 선택이 용이합니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0592 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-763

Tough Decoy (TuD) 디자인 기반


제품 개요

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced expression
  • Puromycin resistance gene for cell selection

Key Features:

  • Potent inhibition of target miRNA
  • Efficient delivery via lentiviral system
  • Long-term inhibition without repeat transfection

제품 스펙

항목 내용
Quality Level 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CCAGCUGGGAAGAACCAGUGGC
Sanger 성숙/소수 수납 번호 MIMAT0003896
microRNA 수납 번호 MI0004516
배송 상태 Dry ice
저장 온도 −70°C

제품 이미지

(이미지 없음)

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.