
Merck MISSION Lenti microRNA Inhibitor, Mouse
강력한 miRNA 억제를 위한 Tough Decoy(TuD) 기반 렌티바이러스형 억제제. 다양한 세포 유형에 효율적으로 전달 가능. 장기적인 억제 효과를 제공하며, 퓨로마이신 선택 마커 포함. −70°C에서 건빙 상태로 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3962
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
The vector includes Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of target miRNA
- Efficient delivery into diverse cell types via lentiviral system
- Long-term inhibition without the need for repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AGGUAGUAGUUUGUACAUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0019340 |
| microRNA 수납 번호 | MI0016967 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



