
Merck MISSION Lenti microRNA Inhibitor, Mouse
포유류 세포에서 miRNA 억제를 위한 렌티바이러스 기반 TuD 디자인 적용 mmu-miR-382-3p 특이적 억제제, 고효율 장기 발현 가능 TRC2-pLKO-puro 벡터 및 퓨로마이신 내성 유전자 포함 −70°C 보관, 드라이아이스 배송
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-382-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA activity.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for selection of transduced cells
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery into diverse cell types
- Enables long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UCAUUCACGGACAACACUUUUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0004691 |
| microRNA 수납 번호 | MI0000799 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



