Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-380-3p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 miRNA 억제제. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 효율적으로 전달 가능. 장기적 억제 효과와 퓨로마이신 내성 선택 기능 제공.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-380-3p
Design Type
- Tough Decoy (TuD)
제품 라인
- MISSION®
품질 등급
제품 형태 및 사양
| 항목 | 내용 |
|---|---|
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | UAUGUAGUAUGGUCCACAUCUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000745 |
| microRNA 수납 번호 | MI0000797 |
| 배송 상태 (Shipping Condition) | Dry Ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달 가능
- 반복 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.