Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-128-2-5p
• 형태: Tough Decoy (TuD)

품질 등급

200 (M-Clarity Program)

제품 라인

MISSION®

물리적 형태

liquid

농도

≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

GGGGGCCGAUGCACUGUAAGAGA

Sanger 성숙/소수 수납 번호

MIMAT0017069

microRNA 수납 번호

MI0000726

배송 상태

dry ice

저장 온도

−70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.

miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.

Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) is included, enhancing transgene expression delivered by lentiviral vectors.
The vector also carries a puromycin resistance gene for selection of transduced cells.

주요 특징

• 강력한 miRNA 억제 효과 제공
• 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
• 반복적 트랜스펙션 없이 장기 억제 가능