Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miR-7a-2-3p 억제를 위한 렌티바이러스 기반 microRNA inhibitor TuD(Tough Decoy) 디자인으로 강력하고 지속적인 miRNA 억제 가능 TRC2-pLKO-puro 벡터 기반으로 다양한 세포에 효율적 전달 puromycin 저항성 유전자를 포함하여 선택적 세포 선별 가능 −70°C에서 드라이아이스 배송 및 장기 보관
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-7a-2-3p
디자인
- Tough Decoy (TuD) 구조
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
주요 사양
| 항목 | 내용 |
|---|---|
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CAACAAGUCCCAGUCUGCCACA |
| Sanger 성숙/소수 수납 번호 | MIMAT0017070 |
| microRNA 수납 번호 | MI0000729 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNA targets.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE), enhancing transgene expression.
Additionally, a puromycin resistance gene enables selection of successfully transduced cells.
특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 포맷으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.