
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-223-5p를 표적하는 Tough Decoy(TuD) 기반 렌티바이러스형 microRNA 억제제. 다양한 세포에 효율적 전달 및 장기적 억제 가능. puromycin 저항성 유전자 포함으로 선택 용이. −70°C에서 건빙 상태로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-223-5p
형태 및 특징
- 형태(Form): Liquid
- 농도(Concentration): ≥1×10⁶ VP/ml (via p24 assay)
- 배송 상태(Shipping Condition): Dry ice
- 저장 온도(Storage Temperature): −70°C
서열 정보
| 항목 | 내용 |
|---|---|
| 성숙 서열 (Mature Sequence) | CGUGUAUUUGACAAGCUGAGUUG |
| Sanger 성숙/소수 수납 번호 | MIMAT0017056 |
| microRNA 수납 번호 | MI0000703 |
품질 등급
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
제품 라인
| 항목 | 내용 |
|---|---|
| Product Line | MISSION® |
기술 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm employs the Tough Decoy (TuD) design.
miRNAs regulate gene expression through various mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression, and a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 목표 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 도입
- 반복적인 트랜스펙션 없이 장기적 억제 유지 가능
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



