
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 디자인 제품 효율적인 세포 전달 및 장기적 miRNA 억제 가능 TRC2-pLKO-puro 벡터 사용, 퓨로마이신 저항성 유전자 포함 건빙(dry ice) 배송, -70°C 보관
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3109-5p
Tough Decoy (TuD) 디자인 기반 렌티바이러스형 microRNA 억제제
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2) to enhance transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- 렌티바이러스 전달 방식으로 다양한 세포에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | AAUGGAUGCGAUGGUUCCCAUGCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0014949 |
| microRNA 수납 번호 | MI0014106 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



