CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor로 특정 miRNA 억제를 위한 강력한 Tough Decoy(TuD) 설계 적용. 렌티바이러스 기반 전달로 다양한 세포에 효율적 도입 가능. 장기적 억제 효과 및 퓨로마이신 선택 마커 포함. −70°C에서 보관.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0262 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-325-5p

Type: Tough Decoy (TuD)


제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 CCUAGUAGGUGCUCAGUAAGUGU
Sanger 성숙/소수 수납 번호 MIMAT0000558
microRNA 수납 번호 MI0000597
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba at the University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.


주요 특징

  • Potent inhibition of target miRNA
  • Lentiviral delivery enables efficient transduction into various cell types
  • Long-term inhibition without repeat transfection

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.