CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

Lentiviral 기반 microRNA 억제제로 강력하고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 설계로 높은 효율 제공. 다양한 세포 유형에 안정적으로 전달 가능. 퓨로마이신 저항성 유전자 포함으로 세포 선택 용이.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0238 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
848,400원VAT 포함 933,240원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-31-5p

Design Type

  • Tough Decoy (TuD)

제품 라인

  • MISSION®

품질 등급

  • 200

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • AGGCAAGAUGCUGGCAUAGCUG

Sanger 성숙/소수 수납 번호

microRNA 수납 번호

배송 상태

  • Dry ice

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes:

  • WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
  • Puromycin resistance gene for efficient selection of transduced cells

주요 특징

  • 강력한 miRNA 억제 효능 제공
  • Lentiviral 전달 포맷으로 다양한 세포 유형에 적용 가능
  • 반복적인 트랜스펙션 없이 장기 억제 가능
  • 퓨로마이신 선택 마커 포함으로 안정적인 세포주 구축 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.