
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 강력하고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 설계로 높은 효율 제공. 다양한 세포 유형에 안정적으로 전달 가능. 퓨로마이신 저항성 유전자 포함으로 세포 선택 용이.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
- mmu-miR-31-5p
Design Type
- Tough Decoy (TuD)
제품 라인
- MISSION®
품질 등급
- 200
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- AGGCAAGAUGCUGGCAUAGCUG
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes:
- WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
- Puromycin resistance gene for efficient selection of transduced cells
주요 특징
- 강력한 miRNA 억제 효능 제공
- Lentiviral 전달 포맷으로 다양한 세포 유형에 적용 가능
- 반복적인 트랜스펙션 없이 장기 억제 가능
- 퓨로마이신 선택 마커 포함으로 안정적인 세포주 구축 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



