Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-31-5p

Design Type

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AGGCAAGAUGCUGGCAUAGCUG

Sanger 성숙/소수 수납 번호

• MIMAT0000538

microRNA 수납 번호

• MI0000579

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of specific miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes:

• WPRE (Woodchuck Hepatitis Post-Transcriptional Regulatory Element2) for enhanced transgene expression
• Puromycin resistance gene for efficient selection of transduced cells

주요 특징

• 강력한 miRNA 억제 효능 제공
• Lentiviral 전달 포맷으로 다양한 세포 유형에 적용 가능
• 반복적인 트랜스펙션 없이 장기 억제 가능
• 퓨로마이신 선택 마커 포함으로 안정적인 세포주 구축 가능