
Merck MISSION Lenti microRNA Inhibitor, Mouse
miRNA 발현 억제를 위한 렌티바이러스 기반 억제제. Tough Decoy(TuD) 디자인 적용으로 강력한 억제 효과 제공. 다양한 세포에 안정적 전달 가능. 장기적 억제 유지 및 퓨로마이신 선택 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-98-5p
Tough Decoy (TuD) Design
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGAGGUAGUAAGUUGUAUUGUU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000545 |
| microRNA 수납 번호 | MI0000586 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70 °C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling effective inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 기반 전달로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자로 세포 선택 용이
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



