Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

• mmu-miR-92a-2-5p

Design Type

• Tough Decoy (TuD)

제품 라인

• MISSION®

품질 등급

• 200

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• AGGUGGGGAUUGGUGGCAUUAC

Sanger 성숙/소수 수납 번호

• MIMAT0004635

microRNA 수납 번호

• MI0000580

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation. These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

• Potent inhibition of target miRNA
• Efficient lentiviral delivery to diverse cell types
• Enables long-term inhibition without repeat transfection