CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 MISSION Lenti microRNA Inhibitor는 Lentiviral TuD 디자인을 기반으로 특정 miRNA를 강력하게 억제합니다. 다양한 세포 유형에 효율적으로 전달되며, 장기간 지속적인 miRNA 억제를 가능하게 합니다. 건빙 상태로 배송되며 −70°C에서 보관합니다.

브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
ADRepligen 웨비나PATsmart를 활용한 바이오공정 분석 전략 · 10/7 오전 10시자세히보기
Merck MLTUD0240 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

Target microRNA

  • mmu-miR-92a-2-5p

Design Type

  • Tough Decoy (TuD)

제품 라인

  • MISSION®

품질 등급

형태

  • Liquid

농도

  • ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

  • AGGUGGGGAUUGGUGGCAUUAC

Sanger 성숙/소수 수납 번호

microRNA 수납 번호

배송 상태

  • Dry ice

저장 온도

  • −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm developed in collaboration with Dr. Hideo Iba (University of Tokyo), based on the work of Haraguchi et al. This algorithm utilizes the Tough Decoy (TuD) design to effectively inhibit target miRNA activity.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation. These lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

  • Potent inhibition of target miRNA
  • Efficient lentiviral delivery to diverse cell types
  • Enables long-term inhibition without repeat transfection

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.