CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스 mmu-miR-194-5p를 표적으로 하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제 가능. 다양한 세포 유형에 효율적으로 전달되며, 퓨로마이신 내성 유전자를 포함. -70°C에서 보관.

카탈로그번호
MLTUD0110
브랜드
Merck Sigma
카테고리
RNA/DNA Reagents
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0110 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

  • mmu-miR-194-5p

설계 방식

  • Tough Decoy (TuD) 구조 적용

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.

주요 특징

  • 강력한 표적 miRNA 억제 효능
  • 렌티바이러스 전달 형식으로 다양한 세포 유형에 적용 가능
  • 재형질감염 없이 장기 억제 가능

제품 사양

항목 내용
Quality Level 200
Product Line MISSION®
Form Liquid
Concentration ≥1×10⁶ VP/ml (via p24 assay)
Mature Sequence UGUAACAGCAACUCCAUGUGGA
Sanger Accession No. MIMAT0000224
microRNA Accession No. MI0000733
Shipping Condition Dry ice
Storage Temperature −70°C

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.