
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-200b-3p를 타겟하는 MISSION Lenti microRNA Inhibitor. Tough Decoy(TuD) 디자인으로 강력한 miRNA 억제 효과 제공. 렌티바이러스 전달로 다양한 세포에 효율적 도입 가능. 장기적 억제 유지 및 퓨로마이신 선택 가능.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
타겟 microRNA
- mmu-miR-200b-3p
디자인
- Tough Decoy (TuD)
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UAAUACUGCCUGGUAAUGAUGA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000243
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of specific miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
Lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 렌티바이러스 기반 전달로 다양한 세포에 효율적 도입
- 반복 트랜스펙션 없이 장기적 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



