
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 유래 miR-130a-3p 억제용 렌티바이러스 기반 Tough Decoy(TuD) 인히비터. 장기적 miRNA 억제 가능. 다양한 세포형에 효율적으로 전달. 퓨로마이신 내성 유전자 포함으로 안정적 선택 가능.
- 카탈로그번호
- MLTUD0037
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-130a-3p
디자인 타입
- Tough Decoy (TuD)
품질 등급
- 200
제품 라인
- MISSION®
물리적 형태
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- CAGUGCAAUGUUAAAAGGGCAU
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0000156
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design. miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression.
The vector also carries a puromycin resistance gene for selection of transduced cells.
주요 특징
- 강력한 miRNA 억제 가능
- 렌티바이러스 전달 포맷으로 다양한 세포형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적 억제 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



