
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 특정 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계 제품입니다. 다양한 세포 유형에 효율적으로 전달되며, 장기적 억제 효과를 제공합니다. 건빙 상태로 배송되며 −70°C에서 보관합니다.
- 카탈로그번호
- MLTUD0034
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-127-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the tough decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing enhanced expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for cell selection.
주요 특징
- Potent inhibition of the desired miRNA
- Efficient delivery into a wide variety of cell types via lentiviral format
- Enables long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UCGGAUCCGUCUGAGCUUGGCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000139 |
| microRNA 수납 번호 | MI0000154 |
| 배송 상태 | dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



