Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

제품 정보

• Target miRNA: mmu-miR-125b-5p
• Design Type: Tough Decoy (TuD)

품질 등급

200 (M-Clarity Program)

제품 라인

MISSION®

물리적 형태

liquid

농도

≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

UCCCUGAGACCCUAACUUGUGA

Sanger 성숙/소수 수납 번호

MIMAT0000136

microRNA 수납 번호

MI0000725

배송 상태

dry ice

저장 온도

−70 °C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNAs.

miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with appropriate packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.

주요 특징

• 강력한 miRNA 억제 효과
• 다양한 세포 유형에 효율적인 렌티바이러스 전달
• 반복 형질감염 없이 장기적 억제 가능
• 퓨로마이신 저항성 유전자 포함