
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 강력한 miRNA 억제를 위해 TuD(tough decoy) 디자인을 적용한 렌티바이러스 기반 억제제입니다. 다양한 세포주에 효율적으로 전달 가능하며, 장기적 억제 효과와 퓨로마이신 선택 마커를 제공합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
제품 정보
- Target miRNA: mmu-miR-125b-5p
- Design Type: Tough Decoy (TuD)
품질 등급
200 (M-Clarity Program)
제품 라인
MISSION®
물리적 형태
liquid
농도
≥ 1×10⁶ VP/ml (via p24 assay)
성숙 서열
UCCCUGAGACCCUAACUUGUGA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
MI0000725
배송 상태
dry ice
저장 온도
−70 °C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNAs.
miRNAs regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation. The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with appropriate packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력한 miRNA 억제 효과
- 다양한 세포 유형에 효율적인 렌티바이러스 전달
- 반복 형질감염 없이 장기적 억제 가능
- 퓨로마이신 저항성 유전자 포함
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



