
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 렌티바이러스 기반 microRNA 억제제로 강력한 miRNA 억제 기능 제공. Tough Decoy(TuD) 설계로 효율적이고 지속적인 억제 가능. 다양한 세포 유형에 안정적으로 전달 가능하며, puromycin 선택 마커 포함.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-125a-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UCCCUGAGACCCUUUAACCUGUGA |
| Sanger 성숙/소수 수납 번호 | MIMAT0000135 |
| microRNA 수납 번호 | MI0000151 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm applies the Tough Decoy (TuD) design for efficient inhibition of target miRNA.
miRNA are known to regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) to enhance transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력하고 선택적인 miRNA 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
- 반복적 형질감염 없이 장기 억제 가능
- Puromycin 저항성 유전자를 통한 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



