Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-99b-5p

디자인

• Tough Decoy (TuD) 형식

품질 등급

• 200 (M-Clarity Program)

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CACCCGUAGAACCGACCUUGCG

Sanger 성숙/소수 수납 번호

• MIMAT0000132

microRNA 수납 번호

• MI0000147

배송 상태

• Dry Ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 가능
• 다양한 세포 유형에 효율적으로 전달
• 반복적인 트랜스펙션 없이 장기적 억제 유지