
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-590-5p를 표적하는 Tough Decoy(TuD) 형식의 렌티바이러스 기반 microRNA 억제제. 다양한 세포에서 효율적 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 선택 마커 포함. −70°C에서 보관.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-590-5p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the tough decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included for enhanced transgene expression.
This lentiviral vector also carries a puromycin resistance gene for selection of cells.
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery into diverse cell types
- Long-term inhibition without repeat transfection
제품 스펙
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GAGCUUAUUCAUAAAAGUGCAG |
| Sanger 성숙/소수 수납 번호 | MIMAT0004895 |
| microRNA 수납 번호 | MI0005519 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



