Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 유래 miRNA 억제용 렌티바이러스 기반 Tough Decoy(TuD) 인히비터. 고효율 세포 전달 및 장기적 억제 가능. TRC2-pLKO-puro 벡터 기반으로 퓨로마이신 선택 마커 포함. −70°C에서 보관, 드라이아이스 배송.
- 카탈로그번호
- MLTUD0795
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-574-3p
Tough Decoy (TuD)
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | CACGCUCAUGCACACACCCACA |
| Sanger 성숙/소수 수납 번호 | MIMAT0004894 |
| microRNA 수납 번호 | MI0005518 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
microRNA are known to regulate gene expression in various ways, including translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors.
This lentiviral vector also carries a puromycin resistance gene for selection of cells.
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 전달
- 반복 형질감염 없이 장기적 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.