
Merck MISSION Lenti microRNA Inhibitor, Mouse
Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스형 microRNA 억제제. 다양한 세포주에 효율적으로 전달 가능하며, 장기적인 miRNA 억제 효과 제공. 퓨로마이신 내성 유전자 포함으로 안정적 세포 선택 가능. −70°C에서 보관.
- 카탈로그번호
- MLTUD0541
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-744-3p
Tough Decoy (TuD) 설계 기반 렌티바이러스형 microRNA 억제제
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 원하는 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포주에 효율적 도입
- 반복 형질감염 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선택
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CUGUUGCCACUAACCUCAACCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0004820 |
| microRNA 수납 번호 | MI0004124 |
| 배송 상태 (Shipping) | Dry ice |
| 저장 온도 (Storage) | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



