
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-744-5p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계로 강력한 억제 효과 제공. 다양한 세포 유형에 효율적 전달 가능. 퓨로마이신 내성 유전자로 안정적 세포 선택 가능. 장기적 miRNA 억제에 적합.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
대상 microRNA
- mmu-miR-744-5p
설계 방식
- Tough Decoy (TuD) 구조 기반
품질 등급
- 200 (M-Clarity Program)
제품 라인
- MISSION®
제형
- Liquid
농도
- ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열
- UGCGGGGCUAGGGCUAACAGCA
Sanger 성숙/소수 수납 번호
microRNA 수납 번호
- MI0004124
배송 상태
- Dry ice
저장 온도
- −70°C
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for transduction of mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) to enhance transgene expression and a puromycin resistance gene for selection.
주요 특징
- 목표 miRNA의 강력한 억제 가능
- 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 도입
- 반복 형질감염 없이 장기적 억제 유지
- 퓨로마이신 내성 유전자를 통한 안정적 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



