
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor는 Tough Decoy(TuD) 설계를 기반으로 한 렌티바이러스 전달 포맷 제품입니다. miRNA 억제를 효율적으로 수행하며, 장기적 효과를 유지합니다. TRC2-pLKO-puro 벡터에 클로닝되어 퓨로마이신 내성 선택이 가능합니다.
- 브랜드
- Merck Sigma
- 카테고리
- Other Organics
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-542-3p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design. miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles that can transduce mammalian cells.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included to enhance transgene expression.
This lentiviral vector also carries a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 다양한 세포 유형에 효율적 전달 가능
- 반복적인 트랜스펙션 없이 장기적 억제 지속
- 렌티바이러스 기반으로 안정적 유전자 전달
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGUGACAGAUUGAUAACUGAAA |
| Sanger 성숙/소수 수납 번호 | MIMAT0003172 |
| microRNA 수납 번호 | MI0003522 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



