
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-539-5p를 표적하는 MISSION Lenti microRNA Inhibitor. Tough Decoy(TuD) 설계를 적용한 렌티바이러스 기반 억제제. 다양한 세포 유형에 효율적으로 전달 가능하며, 장기적 miRNA 억제 효과 제공. −70°C에서 보관, 드라이아이스로 배송.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-539-5p
Tough Decoy (TuD)
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.
miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles for efficient mammalian cell transduction.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression, and a puromycin resistance gene enables selection of transduced cells.
주요 특징
- Potent inhibition of target miRNA
- Efficient lentiviral delivery across diverse cell types
- Enables long-term inhibition without repeat transfection
제품 사양
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | GGAGAAAUUAUCCUUGGUGUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0003169 |
| microRNA 수납 번호 | MI0003520 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



