
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 mmu-miR-297a-5p를 표적하는 렌티바이러스 기반 microRNA 억제제. Tough Decoy(TuD) 설계를 적용하여 강력하고 지속적인 억제 효과 제공. 다양한 세포에 효율적 전달 가능하며, 퓨로마이신 선택 마커 포함. −70°C에서 보관.
- 카탈로그번호
- MLTUD0150
- 브랜드
- Merck Sigma
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target: mmu-miR-297a-5p
Type: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | AUGUAUGUGUGCAUGUGCAUGU |
| Sanger 성숙/소수 수납 번호 | MIMAT0000375 |
| microRNA 수납 번호 | MI0000395, MI0000397, MI0005488, MI0005489 |
| 배송 상태 (Shipping) | Dry ice |
| 저장 온도 (Storage) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm employs the Tough Decoy (TuD) design, enabling potent inhibition of target miRNAs.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, when co-transfected with compatible packaging plasmids, produces viral particles capable of transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력한 표적 miRNA 억제 효과
- 렌티바이러스 전달 형식으로 다양한 세포에 효율적 적용
- 반복 형질감염 없이 장기적 억제 가능
- 퓨로마이신 내성 유전자를 통한 세포 선택 가능
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



