CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

마우스용 렌티바이러스 기반 microRNA 억제제로 강력한 miRNA 억제 가능. Tough Decoy(TuD) 설계로 장기적 억제 유지. 다양한 세포에 효율적 전달. 푸로마이신 저항성 유전자 포함으로 세포 선택 용이.

카탈로그번호
MLTUD0130
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0130 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-122-3p

Tough Decoy (TuD) Design


제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AAACGCCAUUAUCACACUAA
Sanger 성숙/소수 수납 번호 MIMAT0017005
microRNA 수납 번호 MI0000256
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection of transduced cells.


주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 형식으로 다양한 세포에 효율적 적용
  • 반복적인 트랜스펙션 없이 장기적 억제 유지 가능

제품 이미지

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.