CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계 적용. 다양한 세포 유형에 효율적으로 전달 가능. 장기적인 miRNA 억제 효과 제공. Puromycin 선택 마커 및 WPRE 포함으로 발현 강화.

카탈로그번호
MLTUD0119
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0119 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 miRNA

  • mmu-miR-202-3p

설계 방식

  • Tough Decoy (TuD) 구조 적용
  • Haraguchi 등과 도쿄대학교 Hideo Iba 박사 협력 기반의 독자 알고리즘 사용

제품 정보

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AGAGGUAUAGCGCAUGGGAAGA
Sanger 성숙/소수 수납 번호 MIMAT0000235
microRNA 수납 번호 MI0000245
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of the desired miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector, which, upon co-transfection with compatible packaging plasmids, produces viral particles for transduction of mammalian cells.

The vector includes:

  • Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression
  • Puromycin resistance gene for selection of transduced cells

주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 형식으로 다양한 세포 유형에 효율적 전달
  • 반복적인 트랜스펙션 없이 장기적 억제 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.