CacheBy
Merck MISSION Lenti microRNA Inhibitor, Mouse
AI 생성AI가 생성·보정한 이미지예요. AI는 실수할 수 있으니 실제 제품과 다를 수 있어요.
1 / 2

Merck MISSION Lenti microRNA Inhibitor, Mouse

상품 한눈에 보기

포유류 세포에서 miRNA 발현을 효과적으로 억제하는 렌티바이러스 기반 억제제. Tough Decoy(TuD) 설계로 강력하고 지속적인 miRNA 억제 가능. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포에 안정적 전달. 푸로마이신 내성 유전자로 선택 가능.

카탈로그번호
MLTUD0097
브랜드
Merck Sigma
판매단위
pk
카탈로그 보기

카탈로그

1개 옵션
회원가입 없이 바로 구매하세요
가입하지 않아도 비회원가로 구매하실 수 있습니다.
마지막 업데이트 2026. 01. 28. 오후 05:39
Merck MLTUD0097 MISSION Lenti microRNA Inhibitor, Mouse, 1 PKG pk판매 단위 pk ·
재고 확인 필요
716,600원VAT 포함 788,260원

Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-187-5p

Tough Decoy (TuD) 설계 기반의 렌티바이러스형 microRNA 억제제


제품 스펙

항목 내용
품질 등급 200
제품 라인 MISSION®
형태 Liquid
농도 ≥1×10⁶ VP/ml (via p24 assay)
성숙 서열 AGGCUACAACACAGGACCCGGG
Sanger 성숙/소수 수납 번호 MIMAT0016997
microRNA 수납 번호 MI0000229
배송 상태 Dry ice
저장 온도 −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for potent inhibition of target miRNA.

miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for cell selection.


주요 특징

  • 강력한 miRNA 억제 효과 제공
  • 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 전달 가능
  • 반복적인 트랜스펙션 없이 장기적 억제 유지 가능

Merck Sigma 상품 둘러보기

전체보기

문의

0

아직 등록된 문의가 없어요.