
Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로 효율적이고 지속적인 miRNA 억제 가능. Tough Decoy(TuD) 디자인 적용으로 높은 특이성 확보. 다양한 세포 유형에 안정적으로 전달 가능. Puromycin 저항성 유전자로 선택 용이.
- 카탈로그번호
- MLTUD1092
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-466p-5p
Tough Decoy (TuD) 디자인 적용
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design.
miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles for mammalian cell transduction.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- Lentiviral 전달 포맷으로 다양한 세포 유형에 효율적 전달
- 반복적인 트랜스펙션 없이 장기적인 억제 구현
- Puromycin 저항성 유전자로 안정적인 세포 선택 가능
제품 사양
| 항목 | 내용 |
|---|---|
| 품질 등급 | 200 |
| 제품 라인 | MISSION® |
| 형태 | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UAUGUGUGUGUACAUGUACAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0014891 |
| microRNA 수납 번호 | MI0014078 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 이미지
(이미지 없음)
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



