Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-3081-3p

형식

• Tough Decoy (TuD)

품질 등급

• 200

제품 라인

• MISSION®

형태

• Liquid

농도

• ≥1×10⁶ VP/ml (via p24 assay)

성숙 서열

• UUGCGCUCCGAUCUCUGAGCUGG

Sanger 성숙/소수 수납 번호

• MIMAT0014871

microRNA 수납 번호

• MI0014044

배송 상태

• Dry ice

저장 온도

• −70°C

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve potent inhibition of target miRNA.

miRNA are known to regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

Additionally, the vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element 2 (WPRE) for enhanced transgene expression and a puromycin resistance gene for cell selection.

주요 특징

• 강력한 miRNA 억제 효과 제공
• 렌티바이러스 전달 포맷으로 다양한 세포에 효율적 도입 가능
• 반복적인 트랜스펙션 없이 장기 억제 가능
• 퓨로마이신 내성 유전자를 통한 안정적 세포 선택 가능