Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 miRNA 억제를 위한 렌티바이러스 기반 Tough Decoy(TuD) 설계. 효율적이고 지속적인 miRNA 억제 가능. Puromycin 저항성 유전자를 포함하여 세포 선택 용이. −70°C 보관, 드라이아이스 배송. 연구용으로 다양한 세포주에 적용 가능.
- 카탈로그번호
- MLTUD1017
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target miRNA: mmu-miR-3078-5p
Design: Tough Decoy (TuD)
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CAAAGCCUAGACUGCAGCUACCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0014864 |
| microRNA 수납 번호 | MI0014041 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design for effective miRNA inhibition.
miRNAs regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection of this vector with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and carries a puromycin resistance gene for selection.
주요 특징
- 강력하고 특이적인 miRNA 억제 가능
- 렌티바이러스 전달로 다양한 세포주에 효율적 적용
- 재형질감염 없이 장기적 억제 유지
- Puromycin 저항성 유전자를 통한 선택 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.