
Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스용 MISSION Lenti microRNA Inhibitor로 특정 miRNA를 강력히 억제. Lentiviral 포맷으로 다양한 세포에 효율적 전달 가능. 반복적인 트랜스펙션 없이 장기적 억제 유지. Tough Decoy(TuD) 설계 기반으로 높은 안정성과 특이성 제공.
- 카탈로그번호
- MLTUD1006
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-3072-3p
Tough Decoy (TuD) Design
제품 개요
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design, enabling potent inhibition of target miRNA.
Lentiviral delivery allows efficient transduction across diverse mammalian cell types and supports long-term inhibition without repeated transfection.
Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) enhances transgene expression, and the lentiviral vector includes a puromycin resistance gene for cell selection.
주요 특징
- 강력한 miRNA 억제 효과
- Lentiviral 포맷으로 다양한 세포 유형에 효율적 전달
- 반복 트랜스펙션 없이 장기적 억제 가능
- WPRE 포함으로 발현 강화
- 퓨로마이신 내성 유전자 포함
제품 스펙
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UGCCCCCUCCAGGAAGCCUUCU |
| Sanger 성숙/소수 수납 번호 | MIMAT0014853 |
| microRNA 수납 번호 | MI0014035 |
| 배송 상태 | Dry ice |
| 저장 온도 | −70°C |
참고 정보
miRNA는 번역 억제, mRNA 절단, 데드에닐화 등 다양한 방식으로 유전자 발현을 조절합니다.
본 제품은 TRC2-pLKO-puro 벡터에 클로닝되어 있으며, 적절한 패키징 플라스미드와 함께 공동 트랜스펙션 시 바이러스 입자를 생산하여 포유류 세포에 전달할 수 있습니다.
Merck Sigma 상품 둘러보기
전체보기문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.



