Merck MISSION Lenti microRNA Inhibitor, Mouse
Lentiviral 기반 microRNA 억제제로, 다양한 세포주에 효율적으로 전달 가능. Tough Decoy(TuD) 설계를 통해 강력하고 지속적인 miRNA 억제 구현. puromycin 내성 유전자를 포함하여 안정적 세포 선택 가능. −70°C에서 보관, 드라이아이스로 배송.
- 카탈로그번호
- MLTUD0996
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
Target microRNA
mmu-miR-3068-5p
Tough Decoy (TuD) Design
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| Form | Liquid |
| 농도 | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 | UUGGAGUUCAUGCAAGUUCUAACC |
| Sanger 성숙/소수 수납 번호 | MIMAT0014842 |
| microRNA 수납 번호 | MI0014030 |
| 배송 상태 | Dry Ice |
| 저장 온도 | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al., in collaboration with Dr. Hideo Iba (University of Tokyo). This algorithm employs the Tough Decoy (TuD) design, enabling potent and specific inhibition of target miRNAs.
miRNAs regulate gene expression through various mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection with compatible packaging plasmids produces viral particles suitable for transduction into mammalian cells.
The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced expression and carries a puromycin resistance gene for cell selection.
주요 특징
- 강력하고 선택적인 miRNA 억제 가능
- Lentiviral 포맷으로 다양한 세포주에 효율적 전달
- 반복적인 트랜스펙션 없이 장기 억제 유지
- puromycin 내성 유전자를 통한 안정적 세포 선택
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.