Merck MISSION Lenti microRNA Inhibitor, Mouse

MISSION® Lenti microRNA Inhibitor, Mouse

대상 microRNA

• mmu-miR-1964-3p

디자인

• Tough Decoy (TuD) 구조 적용
• Haraguchi, T. 및 Tokyo 대학 Hideo Iba 박사와 협력 개발 알고리즘 기반

품질 등급

• 200

제품 라인

• MISSION®

물리적 형태

• Liquid

농도

• ≥ 1×10⁶ VP/ml (via p24 assay)

성숙 서열

• CCGACUUCUGGGCUCCGGCUUU

등록 정보

배송 및 보관

제품 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. and Dr. Hideo Iba (University of Tokyo).
This algorithm utilizes the Tough Decoy (TuD) design to achieve efficient inhibition of target miRNA.

miRNA regulate gene expression through translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector.
Co-transfection with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.

The vector includes the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) for enhanced transgene expression and a puromycin resistance gene for selection.

주요 특징

• 강력한 miRNA 억제 효과 제공
• 렌티바이러스 전달 형식으로 다양한 세포주에 효율적 적용
• 반복적인 트랜스펙션 없이 장기적인 억제 가능
• 퓨로마이신 저항성 유전자로 선택 용이