Merck MISSION Lenti microRNA Inhibitor, Mouse
마우스 microRNA 억제용 렌티바이러스 기반 인히비터로, 효율적이고 지속적인 miRNA 억제를 제공합니다. TRC2-pLKO-puro 벡터에 클로닝되어 다양한 세포주에 적용 가능하며, puromycin 선택 마커와 WPRE 요소로 높은 발현 효율을 보장합니다.
- 브랜드
- Merck Sigma
- 카테고리
- RNA/DNA Reagents
- 판매단위
- pk
카탈로그
1개 옵션 · 카탈로그 번호를 클릭하면 복사됩니다Merck Sigma · Merck MISSION Lenti microRNA Inhibitor, Mouse
MISSION® Lenti microRNA Inhibitor, Mouse
mmu-miR-1933-3p
제품 정보
| 항목 | 내용 |
|---|---|
| Quality Level | 200 |
| 제품 라인 | MISSION® |
| 형태 (Form) | Liquid |
| 농도 (Concentration) | ≥1×10⁶ VP/ml (via p24 assay) |
| 성숙 서열 (Mature Sequence) | CCAGGACCAUCAGUGUGACUAU |
| Sanger 성숙/소수 수납 번호 | MIMAT0009397 |
| microRNA 수납 번호 | MI0009922 |
| 배송 상태 (Shipping Condition) | Dry ice |
| 저장 온도 (Storage Temperature) | −70°C |
제품 설명
Individual lenti microRNA inhibitors are designed using a proprietary algorithm based on the work of Haraguchi, T. et al. in collaboration with Dr. Hideo Iba, University of Tokyo.
This algorithm utilizes the tough decoy (TuD) design.
miRNA are known to regulate gene expression through mechanisms such as translational repression, mRNA cleavage, and deadenylation.
The lentiviral microRNA inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles suitable for transducing mammalian cells.
The Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) is included to enhance transgene expression.
This lentiviral vector also carries a puromycin resistance gene for selection of successfully transduced cells.
주요 특징
- 강력한 miRNA 억제 효과 제공
- 다양한 세포주에 효율적으로 전달 가능한 렌티바이러스 포맷
- 반복적인 트랜스펙션 없이 장기적인 억제 유지 가능
Merck Sigma 상품 둘러보기
전체보기
문의
0개 · 배송·재고 문의는 실시간 상담이 빠릅니다아직 등록된 문의가 없어요.